Unmethylated CpG dinucleotides in
bacterial DNA or synthetic
oligodeoxynucleotides (ODNs) cause B-cell proliferation and
immunoglobulin secretion, monocyte
cytokine secretion, and activation of natural killer (NK) cell lytic activity and
gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against
malaria. Treatment of mice with
CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of
antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against
infection. A higher level of protection was consistently induced by
CpG ODN 1826 compared with
CpG ODN 1585. The protective effects of both CpG ODNs were dependent on
interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and
nitric oxide were implicated in the
CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of
CpG ODN 1585 in the absence of parasite
antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid
DNA encoding preerythrocytic-stage P. yoelii
antigens. We were unable to confirm whether CD8+ T cells, NK cells, or
nitric oxide were required for the
CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against
malaria.