Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n.

Abstract

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.

• Authors: M Fry, L A Loeb
• Journal: The Journal of biological chemistry (J Biol Chem) Vol. 274 Issue 18 Pg. 12797-802 (Apr 30 1999) ISSN: 0021-9258 [Print] United States
• PMID: 10212265 (Publication Type: Journal Article, Research Support, Non-U.S. Gov't, Research Support, U.S. Gov't, Non-P.H.S., Research Support, U.S. Gov't, P.H.S.)

Chemical References

• DNA
• DNA Helicases

Topics

• Base Sequence
• DNA (chemistry)
• DNA Helicases (chemistry, metabolism)
• Fragile X Syndrome (genetics)
• Humans
• Nucleic Acid Conformation
• Trinucleotide Repeats
• Werner Syndrome (enzymology)