Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer.
|
| Abstract |
Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCTɛAGCGGGTACCGAGCTCGAAT; ɛA=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67 fmol/μg DNA/h vs 3.47±1.35 fmol/μg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.
|
|---|---|
| Authors | Philip A J Crosbie, Amanda J Watson, Raymond Agius, Philip V Barber, Geoffrey P Margison, Andrew C Povey |
| Journal | Mutation research (Mutat Res) Vol. 732 Issue 1-2 Pg. 43-6 (Apr 01 2012) ISSN: 1873-135X [Electronic] Netherlands |
| PMID | 22266085 (Publication Type: Journal Article, Research Support, Non-U.S. Gov't) |
| Copyright | Copyright © 2012 Elsevier B.V. All rights reserved. |
| Chemical References |
|
| Topics |
|
Join CureHunter, for free Research Interface BASIC access!
Realize the full power of the drug-disease research graph!