Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Abstract

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

• Authors: Chi Hwa Kim, Hye Zin Hwang, Seng Mi Song, Kyung Hoon Paik, Eun Kyung Kwon, Kwang Bin Moon, Jeong Hyeok Yoon, Cheol Kyu Han, Dong-Kyu Jin
• Journal: Human mutation (Hum Mutat) Vol. 21 Issue 4 Pg. 449-50 (Apr 2003) ISSN: 1098-1004 [Electronic] United States
• PMID: 12655569 (Publication Type: Journal Article, Research Support, Non-U.S. Gov't)
• Copyright: Copyright 2003 Wiley-Liss, Inc.

Chemical References

• DNA
• Iduronate Sulfatase

Topics

• Adolescent
• Child
• Child, Preschool
• DNA (genetics)
• DNA Mutational Analysis (methods)
• Humans
• Iduronate Sulfatase (chemistry, genetics)
• Korea (epidemiology)
• Models, Molecular
• Mucopolysaccharidosis II (diagnosis, enzymology, genetics)
• Mutation
• Protein Structure, Quaternary (genetics)