Growth inhibition and antimetastatic effect of antisense poly-DNP-RNA on human breast cancer cells.

Abstract

The RNase-resistant and membrane-permeable antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNA) against RIalpha subunit of protein kinase A (RIalpha/PKA) has been used to inhibit the growth of human breast cancer MDA-MB-231 cells in vitro and in vivo. This antisense poly-DNP-RNA, with oligonucleotide sequence GGGCGUGCCUCCUCACUGGC, was found to be an effective concentration-dependent inhibitor of MDA-MB-231 cell line, whereas the control poly-DNP-RNAs with either random or sense sequence were found completely inactive. In situ hybridization studies showed that this antisense inhibitor can permeate spontaneously into MDA-MB-231 cells and distribute itself throughout the cytoplasm. Intraperitoneal administration of this antisense RIalpha poly-DNP-RNA to SCID mice with transplanted MDA-MB-231 cells was found to inhibit the growth of the xenografts in a concentration-dependent way, prevent metastasis, and drastically reduce mortality.

• Authors: K Ru, S Schmitt, W I James, J H Wang
• Journal: Oncology research (Oncol Res) Vol. 11 Issue 11-12 Pg. 505-12 ( 1999) ISSN: 0965-0407 [Print] United States
• PMID: 10905562 (Publication Type: Journal Article)

Chemical References

• Oligoribonucleotides, Antisense

Topics

• Animals
• Bone Marrow Cells (drug effects)
• Breast Neoplasms (drug therapy)
• Drug Screening Assays, Antitumor
• Female
• Hematopoiesis, Extramedullary (drug effects)
• Humans
• Mice
• Mice, SCID
• Oligoribonucleotides, Antisense (pharmacology, therapeutic use)
• Tumor Cells, Cultured (drug effects)