HOMEPRODUCTSSERVICESCOMPANYCONTACTFAQResearchDictionaryPharmaMobileSign Up FREE or Login

ODN ID35

Also Known As:
ACTTTCGTTTTCTGCGTCAA
Networked: 1 relevant articles (0 outcomes, 0 trials/studies)

Bio-Agent Context: Research Results

Experts

1. He, Fang: 1 article (03/2005)
2. Kitazawa, Haruki: 1 article (03/2005)
3. Morita, Hirotsugu: 1 article (03/2005)
4. Katoh, Shinichiro: 1 article (03/2005)
5. Iliev, Iliyan D: 1 article (03/2005)
6. Saito, Tadao: 1 article (03/2005)
7. Hosoda, Masataka: 1 article (03/2005)
8. Shimosato, Takeshi: 1 article (03/2005)

Related Diseases

1. Necrosis

Related Drugs and Biologics

1. Interleukin-18 (Interleukin 18)
2. Interleukin-12 (IL 12)
3. Tumor Necrosis Factor-alpha (Tumor Necrosis Factor)
4. Messenger RNA (mRNA)
5. Interleukins
6. Interferon-gamma (Interferon, gamma)